Nicely Played, Senator Warren

Message from my favorite Senator, just as I was about to go to bed…

… I’m not afraid of the facts, so today we’re launching a new Fact Squad website for anyone who wants see the facts for themselves:

http://www.elizabethwarren.com/heritage

This new website has more than you’d ever want to know about the smears, made-up quotes, and invented stories thrown at me . It has personnel files. It has interviews with the people who hired me – and it has my own family members’ opinions about the attacks.

At that point, I could have quit, but I took the extra step and did a DNA test. One of the world’s leading geneticists did a full work up and concluded that it contains Native American ancestry.

The first Native American in our family that can be proved is generations back, and the geneticist says there could be others. No matter. It’s my family, and – like it or not Donald Trump – my family’s stories are supported by this test…

Pessimists will point out that there are not enough Native Americans in the existing databases to make granular statements, but hey: Senator Warren’s parents told her not just their truth, but the truth about her family history.

Donald Trump owes some charity a million bucks, and I’m sure we’ll see him make good on that public promise just as soon as the biogeneticists introduce their exciting line of flying pigs.






284 replies
  1. 1
    Enhanced Voting Techniques says:

    I am sure that second generation Scots DNA of Trump’s shows he is far more American than Warren. It would be irresposable not to speculate than Trump wasn’t really born in Scotland.

  2. 2
    Betty Cracker says:

    Good for her. The video is especially effective, interspersed as it is with Trump and other Republicans demonstrating that they’re racist assholes for all the world to see. Of course, it’s not telling us anything we don’t already know on that score. But perhaps the real audience is the media.

    I never thought this dumb controversy had the potential to derail Warren like emails derailed Clinton — it’s a straightforward thing that can’t be conflated with a thousand other things, and the implications were trivial, especially after the Globe piece that completely debunked the idea that Warren benefited professionally from her heritage. But we’ll see if this puts to rest any lingering media bullshit outside the Fox/Breitbart bubble.

  3. 3
    Betty Cracker says:

  4. 4
    Tokyokie says:

    As someone who was born and raised in Oklahoma and whose grandfather participated in the 1889 Land Run, I’m as Okie as an Anglo guy can be. And I can assure you that lots of the folks with whom I went to school, who look just as white as Sen. Professor Warren, have stories similar to hers. It’s just not a big deal in Oklahoma, like it sees to be to some raving asshole from the East Coast. Sen. Professor Warren’s claims of Native American ancestry have a lot more validity than der Trumpenführer’s claims to be hyper-rich and hyper-intelligent do.

  5. 5
    SFAW says:

    @Betty Cracker:

    especially after the Globe piece that completely debunked the idea that Warren benefited professionally from her heritage.

    Fake news, BC

  6. 6
    SFAW says:

    @Betty Cracker:

    Re: that million dollars thing:

    “Hi MbS … lissen — you gotta spare 10 Mil I can have? I gotta make a payment to bail out one of my political enemies, she got into trouble making claims that were proved to be FAKE, but if I can’t be charitable towards my enemies, well .. What’s that? Yes, I can make the whole Khashoggi thing go away, I got Junior working on it already. So … you’re good for the 10 Mil?”

  7. 7
    JPL says:

    @Tokyokie: Trump can’t even prove that he’s not a baby, although he keeps trying.

  8. 8
    germy says:

    Are we sure Elizabeth isn’t a balloon-juice commenter?

    I took this test and released the results for anyone who cares to see because I’ve got nothing to hide. What are YOU hiding, @realDonaldTrump? Release your tax returns – or the Democratic-led House will do it for you soon enough. Tick-tock, Mr President.— Elizabeth Warren (@elizabethforma) October 15, 2018

  9. 9
    Betty Cracker says:

    Someone on Twitter pointed out that this dumb controversy provided an opportunity for Warren to emphasize that she’s from a working class Oklahoma family. This is true, and if it blows up in the face of the lying, cheating shit-stain who craps in golden toilets at self-branded resorts, so much the better.

  10. 10
    Mike J says:

    Deadbeat Donnie never pays what he owes.

  11. 11
    zhena gogolia says:

    Nothing ever blows up in his face.

  12. 12
    Tokyokie says:

    Oh, and let me add that as a descendant of Rebecca Rolfe (aka Pocahontas, and yes, I have the papers somewhere), der Trumpenführer gives me additional reason to despise his adipose-laden digestive tract. (Wish we still had the edit function……)

  13. 13
    Baud says:

    Y’all funny thinking the definitive truth with end the “controversy.”

  14. 14
    Amir Khalid says:

    @Tokyokie:
    Your comment confirms what I’ve thought all along: that having Native ancestry is not unusual among white people from that part of America, and that whether Warren herself had such ancestry should never have been a controversy.

  15. 15
    WaterGirl says:

    That Senator Professor Warren made this video tells me she is running for President in 2020. Does anyone disagree?

  16. 16
    M31 says:

    @germy:

    “Mr. President, motherfucker, ah but I repeat myself”

  17. 17
    Jim, Foolish Literalist says:

    did SPW even talk about this in her political career? As I recall, it all started with a Boston radio goober named Howie Carr who was trying to discredit her creds as a Hah-vahd professor, after said school near Boston used her faculty reception chit-chat to boost their stats on faculty diversity.

  18. 18
    Baud says:

    @WaterGirl: I always thought she was, but I know others disagree.

  19. 19
    different-church-lady says:

    @zhena gogolia: Everything blows up in his face. But he continues to be the star of the cartoon.

  20. 20
    M31 says:

    @WaterGirl:

    that was my exact thought when I saw this “ok so she’s running”

  21. 21
    Jim, Foolish Literalist says:

    @Baud: twitter is going to break under the weight of moving goal posts on the right, but we can have some fun pestering trump to cough up the million he promised an doesn’t have

    @WaterGirl: she was as explicit about as you’ll hear a pol be a couple of weeks ago, said she was looking into it, none of that “President? Oh my no, I’m going to speak at Tom Harkin’s steak fry cause I love me some fried steak”

  22. 22
    Baud says:

    @different-church-lady:

    All of his success is based on a simple question: “What are you gonna do about it?” For too many people, supporting the opposing party is simply off the table as a response.

  23. 23
    Gin & Tonic says:

    @Jim, Foolish Literalist: You recall correctly.

  24. 24
    different-church-lady says:

    Won’t stop the bullies one bit. She’ll still win her senate race in a romp, but the assholes will just find a new way to asshole. Playground rules, now and forever.

    Curious thing going on with the yard signs here: Warren for senate at the top, and then below, a kind of “oh, and while you’re voting for her, there’s a Democrat running for Governor who’s going to get crushed by Charlie Baker, vote for him too” as second on the bill. Her coat tails seem to be the only hope.

  25. 25
    WaterGirl says:

    @Betty Cracker:

    But we’ll see if this puts to rest any lingering media bullshit outside the Fox/Breitbart bubble.

    Nothing will ever put this to rest. It’s like Barack Obama’s birth certificate.

  26. 26
    Kraux Pas says:

    At times I’m a little worried because in my corner of the commonwealth it’s “Diehl for Senate” signs as far as the eye can see.

    Then I remind myself that signs don’t vote and I got my boyfriend registered and will bring him to vote for the first time since Obama. This video and the Globe headline give me a little hope that the truth will break through the din of lies. I think things will be better after November. And even if only a little bit, it’s worth it.

  27. 27
    WaterGirl says:

    @Betty Cracker: Go Elizabeth!

  28. 28
    WaterGirl says:

    Apologies for going OT, but I just got a text from a friend whose husband is in the hospital with “Crazy high ammonia levels in his blood with no explanation for it”. He is semi-conscious.

    Has anyone here ever heard of that? Does anyone know what/how that happens?

  29. 29
    zhena gogolia says:

    My husband will love this video. He adores her.

  30. 30
    rk says:

    I think it’s wrong that she did this. It achieves nothing other than show weakness. Trump and all republicans are liars and evil. Like all bullies they’ll twist this information and use it to say something even more nasty about her. This is not how you fight bullies. Her only response to Trump and others should have been to tell them to fuck off. Same with Obama. He achieved nothing by showing his certificate. Everyone knew that Obama was born in the US. Those who said he didn’t also knew it. It was not about his birth certificate any more than it’s about Warrent’s ancestry or about Ted Cruz’s father murdering JFK. They’ll move seamlessly onto attacking her about something else. You fight bullies, not cater to them. You never ever acknowledge even the validity of their question. It’s like she ran crying from the playground to her mommy and got a piece of paper to show the big bully that “I too am a native American”.

  31. 31
    germy says:

    .@BernieSanders on Democratic protesters: "I am not a great fan of being rude or disrupting activities." #CNNSOTU— State of the Union (@CNNSotu) October 14, 2018

    What’s your problem with peaceful Democratic protesters Bernie? The fact that they are largely women? Cat sure had your tongue when your bros were throwing chairs over at the Democratic convention in Las Vegas.— Lisa Glass (@LMplusG) October 14, 2018

  32. 32
    zhena gogolia says:

    @different-church-lady:

    Yes, that’s a more precise formulation.

  33. 33
    Jim, Foolish Literalist says:

    the mouth-breathers won’t care, but…

    Kaitlan Collins @ kaitlancollins
    Trump denies offering to pay $1 million to the charity of Elizabeth Warren’s choice if she proved her Native American heritage. He did.

    John Harwood @ JohnJHarwood
    Trump was just asked about his $1-M pledge on WH lawn: “i never said that”

  34. 34
    Kay says:

    @Baud:

    Y’all funny thinking the definitive truth with end the “controversy.”

    True. Now we’ll get six months on how Warren handled the controversy and whether she’s too controversial.

    You have to try, though. Not trying isn’t an option. I like her- I think she is one of the few Democrats with a coherent economic philosophy that in integrated with the rest of the platform and that she can explain but let’s not kid ourselves about the gender issues this time. It’s not our fault but it is our problem. Plan for it. Bake it in. It exists.

  35. 35
    germy says:

    @WaterGirl:

    Your liver may not work properly if you have high levels of ammonia in your blood. Ammonia is a chemical made by bacteria in your intestines and your body’s cells while you process protein. Your body treats ammonia as a waste product. … This can sometimes happen if you have kidney or liver failure.

    https://www.urmc.rochester.edu/encyclopedia/content.aspx?ContentTypeID=167&ContentID=ammonia

  36. 36
    OzarkHillbilly says:

    @WaterGirl: I suspect kidney/liver problems.

  37. 37
    MazeDancer says:

    Powerful stuff.

    Have no idea if it will help Warren’s White House run, but every time anti-Trump women in a swing state view it, turnout increases, another House Seat flips.

    (And speaking of Flipping the House – obligatory nudge: Get addresses to write PostCards for BJ Candidates to help do just that PostCardPatriots.com)

  38. 38
    germy says:

    @rk:

    Like all bullies they’ll twist this information and use it to say something even more nasty about her.

    Normally tribes require you to be, at a minimum, one-sixteenth Native American to be eligible for consideration. So the DNA test actually proves Warren faked her claim to Indian identity for professional advancement https://t.co/3QV0iwogVe— Dinesh D'Souza (@DineshDSouza) October 15, 2018

  39. 39
    OzarkHillbilly says:

    @rk:

    This is not how you fight bullies.

    You got beat up a lot, didn’t you?

  40. 40
    BlueGirlFromWyo says:

    But was it the long form DNA test? I wish I was kidding.

  41. 41
    Jim, Foolish Literalist says:

    @rk: Yeah, I hope Warren doesn’t turn out to be as weak and dumb as Obama. All that fucker knew how to do was win elections! Where was the gratification of my demands for emo theatrics!

    @germy: one of best things about Warren in the primaries would be the chance that she can shut that toxic motherfucker the fuck up

  42. 42
    Amir Khalid says:

    @rk:
    Trump was obviously never going to fuck off with that “Pocahontas” nonsense. He’s not going to fuck off now, either. So what should Warren do, then?

  43. 43
    Chyron HR says:

    @germy:

    @BernieSanders on Democratic protesters: “I am not a great fan of being rude or disrupting activities.”

    I wish he’d die peacefully in his sleep, but I know that his worshipers would just say the Democrats had him SILENCED.

  44. 44
    Kay says:

    @rk:

    It isn’t for them, though. She’s talking to voters. We can’t just talk to the opposition and political media. You have to keep trying to reach actual voters. To give up on that is to hand the whole thing to them and then who wants to be President? The worst people.

  45. 45
    Betty Cracker says:

    @rk: I couldn’t possibly disagree more. Ask President John Kerry how largely ignoring the Swiftboat liars worked out for him. This IS fighting back. No, it won’t convince the Trumpanzees nor stall the Fox News/Breitbart propaganda machine, but that’s not where the battle is fought.

  46. 46
    Immanetize says:

    @rk: Wow, you are seriously deep into the enemy’s plans

  47. 47
    WaterGirl says:

    @OzarkHillbilly: He got an e coli infection earlier this year that compromised his heart and his kidneys, but he has been stable. He had liver issues a couple of years ago, and he was on the transplant list for a year or two but they took him off the list a year ago because he was doing so well on the meds. He is also diabetic.

    But this ammonia thing came out of the blue.

  48. 48
    Gin & Tonic says:

    @germy: Dinesh, on the other hand, is 100% asshole. And a convicted felon.

  49. 49
    germy says:

    @Gin & Tonic: He’s the best they have to offer, “intellectual” -wise.

  50. 50
    --bd says:

    @Amir Khalid: Ask “Where’s the $1,000,000 check, you liar?” Every damn time.

  51. 51
    WaterGirl says:

    @Betty Cracker: The plus here is that Trump promised a million bucks and this makes him look the ridiculous blowhard he is. But his base will never see that.

  52. 52
    SFAW says:

    @germy:

    She never said she was being “considered” (whatever the fuck that means), you lying fuck.

    D’Felon D’Douche-a never was on a first-name basis with truth or reality, so what else is new?

  53. 53
    Kay says:

    @Chyron HR:

    Bernies weirdly apologetic about the Democratic base. Well, maybe not weirdly, since they’re not his base.

    I wish he’d stop apologizing for us. I’m not ashamed. There wouldn’t have been ANY examination of Kavanaugh without the protesters. There was little enough even when they held up the coronation. We still don’t know who paid his debts and why he lied so much.

  54. 54
    SFAW says:

    The “I never said that” is about what I expected from Lying Littledick. Next up: “I never called her ‘Pocahontas’! “

  55. 55
    OzarkHillbilly says:

    @WaterGirl: I don’t know about liver transplants but it is not at all uncommon for people to go on the list for kidney transplants after their kidneys stop working altogether, only to come off the list when the kidneys start up again (happened to a friend) With your friends history, this isn’t exactly “out of the blue”, more like a “We need to keep a watch on you”, or at least that is what this IRL carpenter and on-line medical consultant thinks.

  56. 56
    rk says:

    @OzarkHillbilly:

    You got beat up a lot, didn’t you?

    Yes as a matter of fact I was. I was also sexually groped by a bully, so it’s painful for me to see someone catering to a bully.

  57. 57
    M31 says:

    @BlueGirlFromWyo:

    long form DNA test results: DAATAGATTAGAGATTTTTAGAGAGATTAGAGAGATTTAGAGGATATAGAG etc. etc.

  58. 58
    OzarkHillbilly says:

    @–bd:

    Ask “Where’s the $1,000,000 check, you liar?” EVERY DAMN TIME.

    FTFY, free of charge for first time customer.

  59. 59
    Fair Economist says:

    @WaterGirl: Ammonia is detoxified by the liver, so maybe it’s part of the liver failure which is not being treated by the meds. It’s mostly produced by colon bacteria so he might have eaten something that overloaded the system.

  60. 60
    WaterGirl says:

    @OzarkHillbilly: That’s really helpful. I won’t go to the medical sites – some people can do that but I am not one of them.

    All I know about kidney issues is from my dog. I recall the term compensation, where the kidneys can function even in a very compromised state, and then the scales tip ever so slightly and they just can’t compensate any longer.

  61. 61
    eric says:

    @Kay: He is worried about protesting HIM. If (when) he runs, he wont be treated all gentle like……

  62. 62
    M31 says:

    Trump has already denied he promised the $1m, so at least one media person asked him about it.

    I assume that Sen. Warren has lots of video of Trump saying he’d pay.

    The more he’s reacting to others the less he’s setting the agenda and getting no pushback.

  63. 63
    WaterGirl says:

    @Fair Economist: He’s still on liver meds and has been really stable for a couple of years. Maybe this could be the e coli infection rearing its head again?

    I’m trying to get some sense of things as background before I talk to my friend who is already depressed because her mom died a month or two ago.

  64. 64
    OzarkHillbilly says:

    @rk: I got bullied too and the only way I ever stopped it was by punching back and hurting them. I didn’t have to win the fight, I just had to hurt them badly enough that they decided it wasn’t worth the pain.

    She is punching back and punching back is not “catering to a bully”, in fact it’s the only way to get them to stop. This is not going to stop them from continuing with it, what it is going to do is make them “punch like a girl” as in make it totally ineffectual.

    Every argument I have ever been in, my moment of victory always comes when they are reduced to “Fuck you.” They might as well wave a white flag.

  65. 65

    Bernie’s check in rubles must have cleared yesterday.

  66. 66
    Betty Cracker says:

    @M31: Yep — it’s right in the video featured above. He says it at one of his dumb rallies.

  67. 67
    OzarkHillbilly says:

    @Kay:

    We still don’t know who paid his debts and why he lied so much.

    All in due time, Kay, all in due time.

  68. 68
    geg6 says:

    @rk:

    Sorry but she’s not catering to a bully. She’s showing potential voters that what he’s going to say about her is untrue. And now she has something to beat him over the head about with the repudiated pledge. What is she supposed to do? Ignore it? You see how well that went with Kerry. Get into a tit for tat with him over this? It will just drag her image down to his level. Now she can say that she was right and that he has broken another promise and lied about it. Right to his fucking ugly ass face. In my book, that’s how you stand up to a bully.

  69. 69
    kindness says:

    Posted video to facebook. Immediately the likes start rolling in.

    Git ’em Senator Professor.

  70. 70
    geg6 says:

    @eric:

    This exactly. He’s afraid of pink pussy hats.

  71. 71
    cliosfanboy says:

    @Tokyokie: so you’re related to Edith Wilson. Woodrows 2d wife

  72. 72
    OzarkHillbilly says:

    GOP Spending Patterns In At Least A Dozen House Races Signal Defeat

    NEW YORK (AP) — Republicans have begun to concede defeat in the evolving fight to preserve the House majority.

    The party’s candidates may not go quietly, but from the Arizona mountains to suburban Denver to the cornfields of Iowa, the GOP’s most powerful players this midterm season are actively shifting resources away from vulnerable Republican House candidates deemed too far gone and toward those thought to have a better chance of political survival.

    And as they initiate a painful and strategic triage, the early Republican-on-Republican blame game has begun as well.

    GOP operatives connected to several vulnerable candidates complain that the committee responsible for electing House Republicans has failed to deliver on its promise to invest $62 million in political advertising across 11 states this fall, a promise detailed in a September memo that declared, “The cavalry is coming.”

    The operatives spoke on the condition of anonymity to avoid retribution; vulnerable Republican candidates still hope to receive additional financial support over the three weeks before Election Day.

    But if the cavalry is coming, it’s not coming for everyone.

  73. 73
  74. 74
    Marcopolo says:

    This was briefly mentioned two threads ago but I want to repeat it here because I think it is really important.

    The Trump Administration is proposing new rules on how NPS land in the capital can be used for mass protests. If these rules go into place, protests like the March for Women will be much much more difficult to legally plan and make happen.

    Today is the last day to comment on the proposed changes. As someone who drove from St Louis to DC in ’89 & ’92 to protest on the National Mall, I can tell you that being able to make a statement with a couple hundred thousand folks in the nation’s capital without the government placing onerous restrictions on is an important part of our democratic experiment.

    Here’s a link to the ACLU page which briefly outlines the proposed changes and gives a comment link.

    Here’s a link to an article in the Atlantic about the issue.

    And last but not least, good morning everyone!

  75. 75
    waratah says:

    Joe Kennedy was in South Texas Saturday with Beto and Joe praised Elizabeth said she taught him in college and was an excellent teacher, winning a lot of awards.

  76. 76
    Jim, Foolish Literalist says:

    @geg6: What is she supposed to do? Ignore it? You see how well that went with Kerry.

    just looking at twitter, I’m amazed at how many people are suggesting that ignoring him, the “left” ignoring him, would make him shut up

    because trump and his mouth-breathers are only part of the problem

    Rebecca Berg @ rebeccagberg
    While Warren’s DNA analysis might placate some critics, it doesn’t really address why she would professionally identify as a minority/Native American, when in fact it’s a minuscule fraction of her heritage.

    CNN political reporter Rebecca Berg is apparently unaware of the long Boston Globe (I think?) story that debunked the idea that she “professionally identified” as a Native American
    ETA: Speaking of the Globe, there was a similar, minor beef about Kerry in ’04, a putatively liberal Globe columnist who had a real chip on her shoulder about him trying to claim Kerry had faked Irish-ness by marching in the St P’s Day parade

  77. 77
    Ken Shabby says:

    I’ve been pleased and excited about her since she first ran against that Turd Ferguson wannabe boob and his fake truck in Massachusetts. I’ve voted every two years since Bush in 2000 and every four years, before that. But, if she runs in ‘20, I’ll be like a helium balloon in that place. Somebody will have to drag my shoes back on the ground. She is just flat out a formidable person; lovely, able to reduce, communicate and sell complicated issues, charming and an absolute badass. She’d be an excellent president. It’s also about goddamn time we got a look at archaic, useless misogyny and grew the fck up about it, too.

    Smart as hell to get out in front of all this bullsh1t. WashPost had a great article about her strategic work this morning –

    Solid.

  78. 78
    randy khan says:

    I guess this settles the question of whether she’s running for President.

  79. 79
    Brachiator says:

    @Tokyokie: Yep. Warren’s story should not have been a big deal. It is very common, and even if the DNA tests turned out to be negative, it would be irrelevant to the family narrative.

    But white people, especially white conservatives, are stupid about race and ethnicity, and currently love to use race as a weapon. They also love to pretend that there is some absolute wall between good, real white people and nonwhite loser shithole people.

    ETA. The recent announcement that Meghan, Duchess of Sussex, is pregnant, is setting of similar outpourings of racism from frightened fools who desperately cling to ideas of racial hierarchy.

    More ETA. Trump clearly has the asshole gene. Science should try to identity it.

  80. 80
    Enzymer says:

    @WaterGirl: Unusual syndrome, likely causes either massive bacterial infection of the intestines or some form of liver failure. The docs should be frantically trying to get the ammonia levels down while treating the primary cause.

  81. 81
    Ken Shabby says:

    @Betty Cracker:

    That drove me crazy, back then…

    YES. And, she’ll do it exactly right, too. May have been what Michelle Obama meant, going high. Right in the face.

  82. 82
    Tokyokie says:

    @Amir Khalid: Oklahoma is an American oddity inasmuch as it is in the middle of the country, yet wasn’t populated by white people until the late 19th century. Elsewhere in the United States, as Native Americans were forced out of their traditional regions, they were marched to parts of what is now Oklahoma. Eventually, after every other place in the Lower 48 was populated by people of European heritage, such people began casting an envious eye on the Native American lands in the Indian (eastern Oklahoma) and Oklahoma (western Oklahoma) Territories. By the late 19th century, the federal government reclaimed the lands it had bestowed on the Native American tribes and opened them for white settlement. But by then, there was no place else to put the Native Americans, who were basically forced to live side-by-side with the usurpers of their properties. And in such a situation, intermarriage became fairly common, while remaining socially unacceptable. But after a couple of generations of diluting the Native American blood titer, it no longer bore a social stigma.

    But what this really gets down to is a matter of class and white male privilege. As we just saw with the Kavanaugh travesty, some white men who come from the right social background take high office as their birthright. (Surely Trump has no real qualification for office other than an inheritance that allows him the pretense of obscene wealth.) Warren obviously isn’t male, and the social status she has attained, rising from humble middle-class beginnings, has been entirely the result of her high achievement. More so than even Hillary Clinton (who is married to a former president), Warren represents a threat to the country’s paternalistic class system. And the “Pocahontas” slight provides her opponents a way to attack her without seeming overtly misogynistic or protective of the upper class.

  83. 83
    Tokyokie says:

    @cliosfanboy: Indeed I am. When the family visited the Smithsonian when I was a kid, the only thing my mother (I’m descended from the Rolfes on her side of the family) wanted to see was Edith Wilson’s inauguration gown.

  84. 84
    Brachiator says:

    @geg6:
    Warren can’t win against diehard conservative fools. It’s like Obama and the birth certificate and being a Muslim nonsense. Some people will be eager to believe a lie because it gives them a “concrete” reason to dismiss and to hate a candidate.

    And the haters are already moving the goalposts. So now, Warren isn’t Native enough and “obviously” she used affirmative action programs which hurt “real white people.” It’s all bullshit.

    The main thing is that Warren is showing how smart she is in dealing with this. But the bullshit will keep coming. And it is founded in the deep white resentment that Trump keeps stirring and which is the foundation of his presidency.

  85. 85
    Jim, Foolish Literalist says:

    @Jim, Foolish Literalist: I don’t watch CNN, is this youngling as dumb as she seems?

    Rebecca Berg @ rebeccagberg
    For those commenting that I missed Boston Globe’s coverage … Actually I tweeted it at the time.

    Even if EW did not get a professional boost from ID’ing as Native American, doesn’t change that she exaggerated her heritage, as DNA analysis shows

    the DNA proves that “my grandma used to say…” is an “exaggeration”?

  86. 86
    sherparick says:

    A couple of comments.
    1) I am sure Glenn Kessler and other mainstream media fact-checkers will find something to quibble with Senator Warren’s statement, because that is what they do if a Democrat or liberal is involved (they round up their pinocchios for Democrats, they round down for Republicans)

    2) It will irritate the Hell out of Trump to see Warren stealing his frontpage the morning after the 60 minutes interview. Which I expect was part of Senator Warren’s intention (well played Senator Warren). It will bring out his misgyny and his racism and get him off the message of the today.

  87. 87
    WaterGirl says:

    @Enzymer: Thank you.

    Not sure if you have seen the additional details I added later:

    He got an e coli infection earlier this year that compromised his heart and his kidneys, but he has been stable. He had liver issues a couple of years ago, and he was on the transplant list for a year or two but they took him off the list a year ago because he was doing so well on the meds. He is also diabetic. But this crazy-high ammonia thing came out of the blue.

    I know no one can diagnose from afar, but I am fearing the worst. Worst case, could this be a “he could die today” kind of thing if they can’t get it under control ASAP? Or a “he might have to go back on the liver transplant list” kind of thing? Or, as my vet used to say, “we’re not at the end of the road, but we’re on the road”.

    Worried for my friend’s husband, but especially for my friend who is already having trouble getting out of bed after losing her mom recently. I guess I’m trying to figure out if this is a 2-alarm fire or a 4-alarm fire.

  88. 88

    @Jim, Foolish Literalist: Is she a National Review alum like Jonathan Martin or a was a Young R like Jonathan Karl.

    ETA: Wikipedia says she is Washington Examiner alum. Is that a right wing rag?

  89. 89
    sherparick1 says:

    @Jim, Foolish Literalist: As I noted, for the MSM who swallow and repeat Trump’s whoppers without blinking an eye (or any Republicans for that matter), they will hyperventilate on any blemish they can find about a Democrat or a liberal. This goes back to the 1990s and Bill Clinton and Al Gore.

  90. 90
  91. 91
    OzarkHillbilly says:

    @Jim, Foolish Literalist:

    is this youngling as dumb as she seems?

    In a word? Yes.

  92. 92
    Amir Khalid says:

    @schrodingers_cat:
    Going by the Washington Examiner’s rep here, yes it is.

  93. 93
    Tokyokie says:

    @WaterGirl: Unfortunately, a high blood-ammonia level is a “he could die today” kind of thing. Humans live with a blood pH level ranging from about 7.35 to 7.45. Ammonia is alkaline and a high level can throw the blood pH level to a critically high value.

  94. 94
    Amir Khalid says:

    @OzarkHillbilly:
    More likely she’s playing dumb.

  95. 95
  96. 96
    OzarkHillbilly says:

    @schrodingers_cat:

    Wikipedia says she is Washington Examiner alum. Is that a right wing rag?

    Yes.

  97. 97
  98. 98
    Enzymer says:

    @WaterGirl: Biochemist not physician here… but high ammonia is pretty toxic on its own, hence the need to treat that symptom ASAP. Given the poor mans history, I’d be worried. Best thing I can say is to get your friend as much support as you can. And get support for yourself as well.

  99. 99
    OzarkHillbilly says:

    @Amir Khalid: playing to her idiot audience.

  100. 100
    WaterGirl says:

    @Tokyokie: Thank you.

  101. 101

    It would be enlightening to do an excel spread sheet of how many of these supposedly neutral MSM journalists come from RWNJ shops.

  102. 102
    WaterGirl says:

    @Enzymer: Thank you so much. Just got a text. Ammonia 500 at midnight, down to 200 now, still dropping. She said her kids are with her, so that’s good.

  103. 103
    MisterForkbeard says:

    @WaterGirl: No. And that makes me a little sad – she’s going to be immediately crowned the frontrunner (which make our other candidates have a harder time getting their message yet). She’s also *fantastic* where she is, so I’m sorry we’d lose her as a Senator.

  104. 104
    Martin says:

    In other news, my new morning routine of pulling down white supremacy literature keeps getting longer. I now suspect there’s more than one group posting it as in the past the (quite professional looking) materials were thematically similar, and now there’s two different themes. Either they have a larger media budget or we have multiple groups.

    We would occasionally get things posted before Trump got elected, and what was posted was really dog-whistley. Now it’s at least once a week (always over the weekend), often multiple times per week, and there’s nothing subtle about it. Nice glossy flyers of white nazi boys say white nazi boy things.

  105. 105
    Ken Shabby says:

    Came back to ask:

    Why are many commenters (anywhere) saying or likely to say “I like her but she can’t/won’t win”?

    Polls, but they’re wildly inaccurate until much closer to nominations.
    Clinton beat Violent Moron by 3 million votes. Their base is always full of hooting idiots with drool and urine running down their legs. Impervious to change or sanity.

    I’m not the brightest nail in the rack but, all the press can do is slobber about her age. I’ve looked. I don’t see the negatives. Harris is new to me and, in all the best ways. She’s got negatives they’ll break off and beat her over the head with but she’s wicked sharp.

    A lot depends on midterms and, after that, Congress in ‘20. If the creek don’t rise, Warren could get a lot done in that four years. One and Done. These next two years determine whether or not we still have a country or if it’s a haven for flying monkeys and sociopaths.

    I would love it if Warren got her hands on the rudder.

    What’s missing?

  106. 106
    OzarkHillbilly says:

    This move on Warren’s part is interesting mostly because it comes in the context of the news last week that the Senator said that she was not ruling out the idea of running for President in 2020 and that she would make a decision in that regard after the election. What this move on her part shows is that, if she does run, Warren doesn’t intend to sit back and let President Trump or any of her potential Democratic opponents attack her on this or any other issue. Obviously, these results are not going to satisfy anyone who is already inclined to vote against her, but I’m sure she already realized that. Additionally, I tend to doubt that they’ll prove to be decisive as far as the average voter is concerned. As for conservatives, as I said, they will reject the findings out of hand, or seek to dismiss them for one reason or another, something that is already apparent In any case, if this faux controversy regarding Warren’s heritage is all that conservatives have against her, and based on the amount of time they spend talking about it that does seem to be the case at times, then they really must be afraid of her. Come after her based on her ideas and let the argument lead where it might. Concentrating on something as trivial as this is utterly childish and ridiculous. But then, that defines “conservatism” in the era of Trump, doesn’t it?

    – Doug Mataconis at OTB

  107. 107
    Spanky says:

    Witches! Now there’s witches! Who knew?!?!?

    ‘It is a scary time,’ Trump backer Amy Kremer tells MSNBC. Witches ‘are placing a hex on Brett Kavanaugh.’

  108. 108
    Fair Economist says:

    @WaterGirl: A quick medical google indicates high ammonia suggests both liver and kidney failure, and is worse when they occur together. Liver failure could be any of a zillion things but obviously if he’s gotten it from E. Coli before that’s a suspects. Kidney failure, as you know, tends to be progressive.

    Did he take any Tylenol? That can cause or exacerbate either liver or kidney failure. NSAIDs like ibuprofen are bad for the kidneys; not sure about liver.

  109. 109
    MisterForkbeard says:

    @OzarkHillbilly:

    As for conservatives, as I said, they will reject the findings out of hand, or seek to dismiss them for one reason or another, something that is already apparent

    Yeah. The “We know we said she wasn’t native american at all, but she’s actually native but not enough for our standards, so this actually makes us even more correct, FAUXCOHONTAS” response we’re seeing from the right is proof they have no shame.

  110. 110
    Martin says:

    @Jim, Foolish Literalist:

    The unfortunate reality here is that somewhere along her career path her institution asked her to change the ethnicity in her personnel file. For the purposes of national rankings and in some cases federal funding, showing hiring of minority faculty can give a real boost and this is very true among law schools. I’ve seen this game played from the inside.

    She had nothing to gain by doing it (she was already hired) and probably thought she had nothing to lose, either.

  111. 111
    Ocotillo says:

    @sherparick1: In the same vein, I was watching a clip of a-hole in chief the other day at one of his rallies and he described Democrats as “not good people”

    Nary a peep from anyone even on the liberal side. However, Hillary is asked about specific racists that were supporting Trump and described many of Trump’s supporters as a basket of deplorables. That is still whined about by the snowflakes that listen to Fox et al.

    Yet Twitler can call half of the country “not good people” and nobody says a word.

  112. 112
    MisterForkbeard says:

    @Ken Shabby: My guess is that Warren’s going to get the same “She’s an icky old lady, therefore my awesome manliness” response from large numbers of Americans as Hillary, and who then used that as a reason to latch onto rightwing conspiracy theories. I’m not sure those people are gettable, especially since Kamala Harris (your other example) obviously isn’t white and will encounter some of the same issues.

    But Warren does have the same general problem as Hillary, in that she’s a rightwing boogeyman and they’ve already spent years encouraging lies about her and hatred for her, and the press has already internalized some of it. See the response to today’s news, for example.

  113. 113
    Gravenstone says:

    @WaterGirl: A rudimentary search shows high ammonia levels may be indicative of liver or kidney problems. Definitely something the hospital will need to determine the source and then hopefully a means of correcting the underlying problem.

  114. 114
    Martin says:

    @Spanky: I did. One of our good friends is a witch, and if she thought she could put a hex on him, she absolutely would. She’s basically a Unitarian Universalist Pagan with strong feminist views. In other words, a totally normal person.

  115. 115

    @Spanky:

    Witches! Now there’s witches! Who knew?!?!?

    I mean, Alyssa Milano was at his confirmation hearing…

  116. 116
    Butter Emails!!! says:

    @Ken Shabby:

    If she wins, Governor Baker (R) appoints her replacement, likely a Republican who makes “moderate” noises, but votes 100% for GOP policies to the Senate. This individual or Baker himself would then likely run and quite possibly retain the seat for Republicans in the election because the standard Massachusetts applies to Republicans although higher than red states is basically at ground level. Baker has something like a 70% approval in the state and is up 30% on his democratic opponent. This is based on him uttering moderate sounding language from time to time, coming out against the most egregious Trump policies and largely doing nothing besides appearing for photo ops and telling people not to go outside during severe weather events.

  117. 117
    Tokyokie says:

    Until I saw Sen. Professor Warren’s video, I didn’t realize that she’d grown up in Norman. For some reason, I was thinking she’d grown up in Lawton or Durant or someplace just north of the Red River. Too bad James Garner, another staunch Democrat who grew up on the wrong side of the tracks in Norman and claimed Native American heritage, isn’t around to make ads for her. I’m guessing, given that her three brothers are older than her, at least one of them knew him, even though Garner barely attended high school.

  118. 118
    Gravenstone says:

    @germy: Oh look, another ignorant fuckstain heard from. Shut up, D’sleaze.

  119. 119
    Chyron HR says:

    @OzarkHillbilly:

    Warren doesn’t intend to sit back and let President Trump or any of her potential Democratic opponents attack her on this or any other issue.

    Oh, Warren’s not going to let her Democratic primary opponents attack her on any issue? Good fucking luck.

  120. 120
    OzarkHillbilly says:

    @MisterForkbeard: Sigh…. What ever happened to the “One Drop” rule?

  121. 121
  122. 122
    Spanky says:

    And further down the WaPo home page below the news that Meghan Markle is pregnant, there’s a photo essay titled

    What Prince Harry and Meghan, Duchess of Sussex, have been doing since their wedding

  123. 123
    Martin says:

    @MisterForkbeard: Warren and Sanders are very much on opposite sides of an important part of the liberal spectrum. She’s a democratic capitalist and he’s a democratic socialist. Their goals are very similar but their methods for getting there couldn’t be more different. Warren is a threat to the Sanders wing of the party because she’s much harder to attack than say a Michael Bloomberg. We tend to think of capitalists as being businessmen turned politicians, but Warren comes at it from a very different and very difficult angle to attack. Warren is also a much bigger ideological threat to Republicans than Sanders is. I think the GOP feels confident that they can turn Sanders’ socialist message against him, but Warren threatens to reveal that the GOP aren’t really capitalists at all. She’s going to be attacked from all sides for reasons other than her age and gender.

  124. 124
    OzarkHillbilly says:

    @Chyron HR:

    Come after her based on her ideas and let the argument lead where it might.

  125. 125
    Betty Cracker says:

    @schrodingers_cat: Yes, that would be useful. Wingnuts like to pretend that anyone who works for a mainstream news publication is a flaming liberal, but it’s not true.

    There was an interesting little flash in the media pan last week about Kaitlan Collins, the CNN reporter whom Trump likes to beat up on. Log Cabin Republicans (aka Chickens for Colonel Sanders) dug up a homophobic tweets the now-20-something Collins wrote when she was a teen-aged student at the University of Alabama. She apologized for the tweets, but LCR and other wingnut pundits were crowing over the hypocrisy of “liberal media elites” blah blah blah. Collins began her career at The Daily Caller, and if she was using the word “fag” during this century, I’m going to assume she’s not a liberal. But there they were, baying for her head.

    Robert Costa of The Post is an excellent political reporter IMO, but he used to write for National Review. I always keep that in mind. I generally trust him to report facts, but I am suspicious of anything containing supposition.

  126. 126
    Gravenstone says:

    @SFAW: “That’s not my voice. Those aren’t my words. I only have the best word, you know?”

  127. 127
    different-chuch-lady says:

    @rk: [throws glass of water in your face]

    Now you’re hysterical and you’re wet.

  128. 128
    MCA1 says:

    @OzarkHillbilly: I agree completely. No one on the Right was loudly requiring that she produce a DNA test, because they knew (a) she wasn’t lying, and (b) what a non-troversy the whole thing was in the first place. So she’s not succumbing to their demands.

    She got Drumpf to commit an unforced error by continuing to harp on the issue and then to make his worthless million dollar promise, so now she’s in position to pull his shirt over his head and punch him relentlessly. She has the receipts to call him a liar over and over again, while simultaneously hectoring him about not paying up, and ripping him for the racism of calling her Pocahontas. If he ever does pay up (he won’t), now she’s forced him into submission and it’s oh so beta to his degenerate fans. And she can beat on him about not calling her Pocahontas anymore if he stops, or about continuing to call her Pocahontas. It’s lose-lose-lose for Trump here.

    I think it’s pretty cagey, myself. We’ll see if she has the necessary ruthlessness to take this and fashion it into a weapon.

  129. 129
    dm says:

    Re: “I think she’s running”: I really expected Anne or Betty to front page this story about Senator Warren’s fifty-state strategy: https://www.washingtonpost.com/politics/elizabeth-warren-builds-expansive-democratic-campaign-effort-ahead-of-likely-2020-bid/2018/10/14/45f3a0ae-ce5f-11e8-a360-85875bac0b1f_story.html

  130. 130
    Martin says:

    @Spanky: Wow, photos? Boy, the royal family is really dispensing with protocol, aren’t they.

  131. 131
    Yutsano says:

    @Ocotillo: Who should say what exactly? If the Democrats responded to every one of Dolt45’s rants at rallies they’d literally have no time for anything else.

  132. 132
    Barbara says:

    @Spanky: ‘

    It is a scary time,’ Trump backer Amy Kremer tells MSNBC. Witches ‘are placing a hex on Brett Kavanaugh.’

    I realize that in the scheme of things this is a very small complaint, but I am so f’ing tired of these people. Christians do not “believe” in witches or in the power of hexes or spells or whatever else. This is like an admission that this woman does not really believe that there “is one God,” the maker of heaven and earth, etc. The question back to her is whether she believes in the existence of multiple gods or the power of spells.

  133. 133
    MisterForkbeard says:

    @OzarkHillbilly: Like most rules, they can be freely ignored when that would be beneficial to Democrats.

  134. 134
    polyorchnid octopunch says:

    @rk: I disagree. The next step is “so… are you going to cough up? Don’t say the line if you won’t pay the fine. Are you a man of your word, or are you a lying sack of shit? C’mon, do what you said you’d do. Hey everyone… here he is not putting his money where his mouth is. Check it out!”

    And keep tying that to the overall Republican party: “these people are not people of their word. You can’t trust them to do what they say they will do, as you can see here (health care), here (tax policy), here (fiscal policy), and here (SS). You can’t trust these people to do what they’re telling you they’re going to do on the campaign trail. Look at their leader, won’t even cough up less than a tenth of one percent of his money to make good on his wager. His mouth writes checks that his wallet won’t cash… and so does the whole Republican party.”

    Welching on bets is something that even the low information voters will understand.

  135. 135
    MisterForkbeard says:

    @Martin: You might be right about that. I think another big part of it is that they like beating up on women, so Warren is a fantastic target because she’s a girl. And because she did something innocuous 40 years ago that they can pretend is “pretended to be another race for professional gain!”, to justify their hatred, bring in the lazy media, and get the ignorant to dismiss her out of hand.

  136. 136
    dm says:

    @Butter Emails!!!: Massachusetts fills vacant Senate seats by special election. The governor gets to appoint an interim Senator, but they hold office until the special election can take place.

  137. 137
    germy says:

    Any comment from “ambassador” Brown? Didn’t he start that racist crap when he ran and lost against her?

    Possibly he’s too busy with his ambassador duties to make a statement or apology.

  138. 138
    gene108 says:

    @Betty Cracker:

    I never thought this dumb controversy had the potential to derail Warren like emails derailed Clinton — it’s a straightforward thing that can’t be conflated with a thousand other things, and the implications were trivial, especially after the Globe piece that completely debunked the idea that Warren benefited professionally from her heritage. But we’ll see if this puts to rest any lingering media bullshit outside the Fox/Breitbart bubble.

    A lie travels around the world, before the truth puts its shoes on.

    If the right-wing noise machine wants to hammer the point that Warren got her Harvard job because she lied on her application, the BG article will be meaningless. The MSM will just broadcast the right-wing lies, along with the truth, because there are always two sides to every story. Even if one of those sides is a big fat lie.

    After 2016, I think the margin of error for a non-white and/or non-male, running for President, is basically zero. I think she’s gotten ahead of this, but you never know, with regards to the right-wing noise machine. They can beat their drum and get people to pay attention to the silliest damn thing (like the New Black Panther Party, in 2008).

  139. 139
    FlipYrWhig says:

    @germy:

    .@BernieSanders on Democratic protesters: “I am not a great fan of being rude or disrupting activities.” #CNNSOTU— State of the Union (@CNNSotu) October 14, 2018

    Uh, isn’t Bernie Sanders’s entire theory of politics that if you get a big enough crowd outside Mitch McConnell’s window he gives in to your demands?

  140. 140
    OzarkHillbilly says:

    @MCA1:

    We’ll see if she has the necessary ruthlessness

    Yep, tho I want to go on the record right now that I think she does.

  141. 141
    germy says:

    @FlipYrWhig:

    if you get a big enough crowd outside Mitch McConnell’s window he gives in to your demands?

    Maybe a crowd of men, he means. Not like the wimmenz yelling at poor republican senators.

    I don’t know.

  142. 142
    Gin & Tonic says:

    @Martin: I mean, she’s an attractive young lady and all, but I don’t need to see pictures of that.. As the kids say, TMI.

  143. 143
    OzarkHillbilly says:

    @MisterForkbeard:

    and get the ignorant to dismiss her out of hand.

    The ignorant were always going to dismiss her out of hand. Simply because TuckLaurSean told them to.

  144. 144
    Baud says:

    @FlipYrWhig:

    “I am not a great fan of being rude to me or disrupting my activities.”

    Clearer now?

  145. 145
    Fair Economist says:

    @Barbara:

    I realize that in the scheme of things this is a very small complaint, but I am so f’ing tired of these people. Christians do not “believe” in witches or in the power of hexes or spells or whatever else.

    Christians don’t, but “Christians” do, and that’s the opposition.

  146. 146
    Amir Khalid says:

    @FlipYrWhig:
    Don’t you see, leading millions of people to Mitch’s window would obviously be neither rude nor disruptive.

  147. 147
    FlipYrWhig says:

    @Baud: @germy: On top of everything else, one of the reasons why the people who like him like him IS THAT HE’S RUDE. When the celebrity playing you is *Larry David*, it ain’t because you have a reputation for being friendly and polite. A truly strange thing for that particular person to say.

  148. 148
    West of the Rockies says:

    I’m feeling a bit down, so on this morning I suspect the DNA results won’t matter to Trump. He will make a smirky, ugly face, say, “She’s, what, 1%?” He’ll make an uglier face and continue the Pocahontas insults. His ugly base will roll its eyes in group ecstasy.

  149. 149
    Jim Vandewalker says:

    @Amir Khalid: So what should Warren do, then?

    She ought to find an actual documented descendant of Rebecca Rolph, aka Amonute, aka Pocahontas, preferably female, and take her on a couple of campaign appearances. Special fantasy bonus if they both leap into the audience and knock down one of those war whoopin’, tomahawk choppin’ bros and scalp him on live tv.

  150. 150
    Betty Cracker says:

    @dm: What, and open myself up for endless ritual denunciation for taking the focus off of 2018? No thanks.

    @gene108: The MSM is my concern because that’s where the low info voters get their dollop of factoids. I don’t think it’s always true that the MSM just rebroadcasts wingnut lies without rebuttal. That happens in some cases, but there are nuances. For example, most mainstream outlets dismissed the birther nonsense, and during the 2016 campaign, they even hounded Trump a bit for having bought into it and never apologized.

  151. 151
    trollhattan says:

    @Ken Shabby:

    What’s missing?

    Misogyny. It’s why Hillary isn’t 45 and Warren has to climb that same extra mountain. Maybe she can, maybe not, but the same anti-Hillary machine has pivoted to her.

  152. 152
    Baud says:

    @Betty Cracker: Shame on your for responding and taking the focus off of 2018.

  153. 153
    Bobby Thomson says:

    @Betty Cracker: it will, right after Republicans admit they were wrong about Swift Boats for Truth, Benghazi, and Brett Kavanaugh, and Trump admits he was wrong about the birth certificate.

    Things don’t have to be true to get sustained media attention. They just have to be repeated by Republicans. The question isn’t who’s right and whether this will dominate campaign coverage. It’s whether you think it’s no worse than what will be thrown at anyone else.

  154. 154
    Mandalay says:

    @Ocotillo:

    In the same vein, I was watching a clip of a-hole in chief the other day at one of his rallies and he described Democrats as “not good people” Nary a peep from anyone even on the liberal side.

    John Dickerson said that after Kavanaugh got the job TWENTY Democratic Senators were invited to appear on Face The Nation and nobody accepted. WTF???

  155. 155
    germy says:

    Trump on Elizabeth Warren DNA test: "Who cares?" pic.twitter.com/v09uspLM0U— TPM Livewire (@TPMLiveWire) October 15, 2018

  156. 156
    janesays says:

    The Boston Globe botched the math on this in their initial report.

    The DNA analysis said she very likely has a pure Native American ancestor between 6 and 10 generations back. On the low end, that means she very likely has at least 1/1024th Native American ancestry. The Globe noted that “If her great-great-great-grandmother was Native American, that puts her at 1/32nd American Indian.” But 6 generations back would be her great-great-great-great-grandmother, which would be 1/64th Native American. Which means her DNA is somewhere between 0.097% Native American and 1.563% Native American, which even on the high end is way too low for her to be eligible to formally enroll as a member of any tribe in America.

    In any event, the wingnuts are hammering away on the low percentages. I’m not sure the DNA test is going to sway public opinion much either way on this issue.

  157. 157
    Bobby Thomson says:

    @gene108: this.

  158. 158
    KSinMA says:

    @Tokyokie: Hi, Cousin! (And of course there are thousands of us, if not millions!)

  159. 159
    FlipYrWhig says:

    @janesays: Of course “enroll as a member of any tribe” never has had anything to do with it, right? AFAIK she has never said she ever had any intention of doing that.

  160. 160
    Baud says:

    @Mandalay:

    after Kavanaugh got the job

    Hmmm.

  161. 161
    janesays says:

    @Gin & Tonic: Formerly convicted felon, thanks to Cheetolini’s flagrant abuse of the pardon power.

  162. 162
    Baud says:

    @janesays: He’s still convicted.

  163. 163
    janesays says:

    @FlipYrWhig: I know. But that’s where the goalposts are going to be moved by the talking heads at State Media when covering this story.

  164. 164
    Betty Cracker says:

    @Bobby Thomson: In other words, DOOOMED! DOOOOOMED, I SAY.

  165. 165
    OzarkHillbilly says:

    @janesays: @Baud: To accept a pardon he has to first admit guilt.

  166. 166
    OzarkHillbilly says:

    @Betty Cracker: Thank you.

  167. 167
    Mandalay says:

    @Baud: What’s with the fucking Hmmm? You think it’s OK for Democratic Senators to go crawl under a rock when they’re not winning? It’s fucking disgusting that twenty Democratic Senators declined to appear.

  168. 168
    Baud says:

    @Mandalay: Or he sent the invitation so late that the Dems already had other plans? Or he’s lying?

    ETA: My “hmmm” was about wondering why he was focused on how many Dems he invited after the deed was done.

  169. 169
    gvg says:

    I haven’t heard anyone here point out why the right IMO makes such a big deal about this.
    The hate affirmative action and blame a lot of unrelated things on it. They use as a crutch to hide their own lack of success, the idea that companies and organizations are always promoting other minority/women people over them because the law required them to favor that group over ordinary white males. They are convinced of this.
    I work in financial aid at a big state school. there are still people who think there are lots of unclaimed large scholarships for all minorities. I have been here starting as a student then after graduation as a full time employee for 25 years now. There have never in my time been significant minority scholarships. Actually there aren’t very many at all and they tend to be for $500 or less, plus between our enrollment of around 50,000 at a time, you can’t even call it a drop in the bucket.
    Perception lingers though. They also think there are jobs that go to minorities over white men. That is what they think, and I think that is why they are “convinced” she got something she shouldn’t have.
    I am not sure it would help these idiots to explain that nowadays there are so many women and minorities competing for everything that it wouldn’t help to “reserve” any jobs for them. they are all competing in a crowded field too. I expect pointing that out might drive the resentful more insane.

  170. 170
    Spanky says:

    Well, somebody remembered. This is at the top of the CNN site:

    Trump offered $1 million. Now, he says ‘who cares?’

    Welcher-in-Chief

  171. 171
    Butter Emails!!! says:

    @Mandalay:

    Which ones?

  172. 172
    Kraux Pas says:

    @Betty Cracker:

    In other words, DOOOMED! DOOOOOMED, I SAY.

    I’m gonna sing “the Doom Song!

  173. 173
    Msb says:

    I’m with Betty Cracker and Ozark Hillbilly.
    This let’s Warren put out the facts for the interested, and enables her both to demand he $1 million, call him a welshers and bash him for calling her mom a liar.

  174. 174
    janesays says:

    @Baud: I stand corrected. I was under the impression that a pardon effectively removed the conviction, but that apparently is not the case. The conviction remains on someone’s permanent record alongside the pardon. The only thing that can remove a conviction entirely is an expungement, which is not in the power of the president. A pardon does restore all rights that might have been forfeited from a conviction (voting rights, right to bear arms, right to serve on jury).

    https://www.justice.gov/pardon/frequently-asked-questions

  175. 175
    Jeffro says:

    Warren took the test and made her (very small) point…my hope is that she will follow through on the much bigger point, that Trumpov is a wrestling heel who never pays his debts. Except to the debts he owes the Russians, of course, which he can never repay.

    Continuing to respond in any other way to his and his followers’ stupidity is a waste of time, imho.

    Oh and Dems let’s please, please have some fresh faces for 2020. I would love to have some options other than Joe, Liz, and that guy who refuses to actually join the party.

  176. 176
    Litlebritdifrnt says:

    Personally, I think what has been lost in this is Twitler using the clearly racist term “Indian” in that pronouncement. “If she can prove she’s Indian”. No Twitler, read a f*cking book, they are Native American, or Indigenous, or The People. What they are not is “Indians” and were only given that title because the dumb f*ck Columbus was hopelessly lost and thought he had landed in India. This is yet another in the list of 1 million things that Twitler has said that people just ignore as white noise. Anyone else using that term would be excoriated.

  177. 177
    germy says:

    A Mumbai-born right-wing troll named Shiva Ayyardurai is running against Warren in this year’s Senate race using the slogan “Only a real Indian can beat a fake Indian.”

    I wonder if he’ll change his slogan. Probably not.
    http://nomoremister.blogspot.c.....-turn.html

  178. 178

    @Baud: He wanted to drink their tears and mock them. Because that’s how MSM denizens roll.

  179. 179

    @germy: He sounds like an idiot. In Indian elections, every election candidate has to pay a token deposit to contest an election. If you get below a certain % of the vote, you lose your deposit. More than the money lost its the humiliation aspect of this that keeps trolls and vanity candidates like the above mentioned idiot from running.

  180. 180
    Baud says:

    @Litlebritdifrnt: I thought the preferred term was “American Indian.” That’s what the fairly new museum in DC is called.

  181. 181
    FlipYrWhig says:

    @Litlebritdifrnt: For what it’s worth I know more than a few indigenous-identifying people — literature and cultural studies scholars — who do use the word “Indian” to talk about themselves, and among them “Native American” seems out of favor. I don’t think it’s exactly the reclamation of a pejorative (like “queer” and under some circumstances the n-word) but the politics of the word and/as an affiliation of sorts seem pointed and complicated.

  182. 182
    Betty Cracker says:

    @Jeffro: Biden would be a retread because he was VP for eight years, was in the senate since the 1970s, ran for president in the past, etc., but I think Warren counts as a “fresh” face unless by “fresh” you mean “young.” I can understand the desire to get someone younger in there, but personally, I take it on a case-by-case basis, and Warren is energetic and youthful for her age. I wouldn’t write her off. YMMV.

  183. 183
    Gravenstone says:

    @Mandalay: Let’s see some proof that the offers were extended, and done in a manner that allowed for credible replies before we take Dickerson’s claim at face value, shall we?

  184. 184
    OzarkHillbilly says:

    @Litlebritdifrnt: When writing I generally use the term Native American and when writing of a particular individual will reference the tribe they come from if it is pertinent to the discussion. But… when speaking, “Indians ” quite often comes out of my mouth simply because that is what I grew up hearing.

    Not to defend trump, but I hardly feel this is worth excoriation.

  185. 185
    Gravenstone says:

    @Spanky: Dare we say he’s an ‘Indian giver’? Yes, a terrible slur, but at least topical.

  186. 186
    Quaker in a Basement says:

    There are too damn few politicians who speak as plainly and powerfully as Warren. Keep throwing those rocks, ma’am.

  187. 187
    Kraux Pas says:

    @Jeffro:

    Oh and Dems let’s please, please have some fresh faces for 2020. I would love to have some options other than Joe, Liz, and that guy who refuses to actually join the party.

    With you there, though Liz is only just completing her first full term. She’s still pretty fresh. And don’t worry, there’ll be a wealth of fresh candidates in 2020. I wouldn’t even want to make a list for fear of slighting one of the amazing people who have cropped up within the party within the last few years.

    But for the other part, what’s in a registration? He’s with the party when it counts, supporting the Dem caucus for leadership and on most major votes. And he would fade quickly in a large field of candidates, anyway. He mainly sells aspiration. There are plenty of people in the party who can sell broad aspirational goals with the policy chops to give a clearer notion of how that might look to the average voter. Warren is one such person.

    For the record, as a registered Democrat I voted mostly for Republicans and Greens. Since I’ve been a registered “unenrolled,” I’ve been voting almost straight ticket D. Candidates and policies and outcomes matter along with seeing a lot of this unfold over time. Not how whoever is registered.

  188. 188
    Spanky says:

    Hey, a question for all you folks who play doctor on the internet. I pulled a muscle in my back 9 days ago. I mean, reeely pulled it. I was reaching across a big tool chest to yank it into position and felt the thing go. It’s the one that runs up/down about 6 inches off the spine and runs right over the kidney.It still hurts about as much as it did the day after I done the deed.

    Is it normal for a pulled muscle to take so long to heal? If I tore it, would it feel the same?

    I’ve obviously not bothered to go to a doc, because hey, I’ve pulled lots of muscles. But now I’m starting to wonder.

  189. 189
    Elizabelle says:

    @Betty Cracker: I love Elizabeth Warren. She’d make a great president. She gets what life is really like for the middle class. Has been studying and writing about it, accurately, for years.

    Not into ageists. What is wrong with going with some superbly prepared women to help dig us out of the mess that Republican men and those asshats, the evangelicals, have left us?

  190. 190
    MisterForkbeard says:

    @FlipYrWhig: Right – I think this is something that doesn’t actually matter to a ton of people. I’m not convinced most Native Americans care, and I remember the term “Indian” or “American Indian” being used in my public schools as late as the late 90s. In terms of ‘outrage’ value, it’s pretty low to most Americans, even if it is proof that Trump just doesn’t give a shit about norms or politeness.

  191. 191
    Kelly says:

    My grandpa was from Arkansas. That branch of the family spoke of a couple Native Americans in the family tree several generations back. This seems commonplace and unremarkable except to folks picking a fight.

  192. 192
    WaterGirl says:

    @Fair Economist: Thanks, that’s very helpful. Surely they would have told him not to take any of that stuff?

  193. 193
    Jeffro says:

    @Betty Cracker: I do mean younger, actually. Even though I feel like I am getting ‘up there’ myself these days…=)

    @Kraux Pas: registering with the party is a commitment, a willingness to ‘wear’ the label with friends and against foes. It’s also the easiest argument against his candidacy: want to lead the party? Join the party. Glad you are still voting almost straight-ticket D – keep up the good (voting) work!

  194. 194
    WaterGirl says:

    @Gravenstone: Thank you.

  195. 195
    Spanky says:

    @Kraux Pas: Yes, it’s a bit early to start identifying likely 2020 candidates. But it does give me another opportunity to pull out this priceless quote from Peggy “Nooners” Noonan from the aftermath of 2004:

    I do not know what the Democratic Party spent, in toto, on the 2004 election, but what they seem to have gotten for it is Barack Obama. Let us savor.

    Indeed, Nooners. And the next Obamas are out there.

  196. 196
    OzarkHillbilly says:

    @Kraux Pas:

    But for the other part, what’s in a registration?

    A lot. It means helping out other party members when they are in a tough race by either passing on some campaign money you don’t need, stumping on the trail for a fellow DEM if it will help. actively fundraising for a compatriot, and even taking a bullet for the party by voting for a necessary piece of legislation even tho the folks at home will hate it but a majority will vote for you anyway so that another DEM in a much tighter district/state can vote the way his/her constituents want.

    Either one is a Democrat, or one isn’t. And if Wilmer would never help a DEM, why should a DEM help Wilmer?

  197. 197
    MisterForkbeard says:

    @Kraux Pas:

    He’s with the party when it counts, supporting the Dem caucus for leadership and on most major votes. And he would fade quickly in a large field of candidates, anyway.

    I’d agree with this if a huge part of his shtick wasn’t “I’m awesome and pure and the Democrats are establishment whores”, or varying versions of this. He’s also hugely bad at walking this back or directing his people towards the right targets, as we saw in the latter parts of 2016. He’s aspirational, but with the wrong message, and I know several people personally who were pretty good Democrats before 2016 and are now convinced the entire party needs to be brought down. He’s not helping in that respect.

    Additionally, he’ll stand out in a crowded field for the exact same reason, and it will only exacerbate the problem. In a good, strong field of Democrats his big differentiating factor will be that he’s not a Democrat, and everyone else is compromised. It might bring some people in, but it’s also going to harden them against voting for other Democrats, just like it did in 2016.

  198. 198
    OzarkHillbilly says:

    @Spanky: After 9 days, you need a Doc.

    ETA: if you tore the muscle there probably isn’t much they can do besides pain killers and a rest regimen (inc ice and heat) followed by PT.

  199. 199
    JaneE says:

    My story is the same as Elizabeth Warren’s, but I do have one piece of documentation – which is almost certainly wrong, according to the family stories I have been told. Not that the stories always agree with each other, and the most reliable (oldest) witnesses were telling them when I was too young to really understand what was going on, but my guesstimate based on them and the DNA test seem to agree far better than what the documents do.

    Warren and my parents were both Okies, and if her family had lived in the state as long as mine, it would be almost impossible to not have some Cherokee in her ancestry. My cousins (first, second, once and twice removed – all varieties) have somewhere from 1/32 to 1/2 Indian blood. Even though my aunt was hesitant to tell me that her granddaughter married a “full blood Cherokee” – as if that would somehow offend or upset me. And that isn’t even the side of my family with documentation.

    FWIW, my DNA comes in about 3/32. My documentation says 1/1024.

  200. 200
    Emma says:

    Jesus Christ, we have allowed the know-nothings to rent space in our heads. Who the heck cares if they don’t change their minds? And specially who cares if they move the goalposts? I am sure Warren already knew that would happen. It might make the unreliable voters and the undecided (idiots, but there are many who are still dancing that particular foxtrot) think again. I think it was a genius move to put her REPUBLICAN brothers front and center. She has something to fire back at Trump every time he steps out of line.

  201. 201
    Spanky says:

    @OzarkHillbilly: Sigh. Alrighty, then.

  202. 202
    NotMax says:

    200 comments and no one went for “Norman, coordinate?”

    I haz a disappoint.

    :)

  203. 203
    A Ghost To Most says:

    I still want Adam Schiff in 2020. Warren or Biden or Harris or Booker, if it came to it. Gillibrand would require nose holding. YMMV.

    As for terms, I try to use First Americans. It’s a work in progress.

  204. 204
    dm says:

    Betty Cracker:

    What, and open myself up for endless ritual denunciation for taking the focus off of 2018? No thanks

    This is why I didn’t bring it up earlier.

  205. 205
    OzarkHillbilly says:

    @Spanky: A back brace may help as well, tho I only use one when I have an issue with a pinched nerve, not for muscle pain.

  206. 206
    Tokyokie says:

    @Jim Vandewalker: I’ll happily volunteer for such duty! (See comment #12.)

  207. 207
    A Ghost To Most says:

    @Kelly:

    This seems commonplace and unremarkable except to folks picking a fight.

    It’s all they got at this point.

  208. 208
    Amir Khalid says:

    @OzarkHillbilly:
    Joe Arpaio accepted a Presidential pardon, and then petitioned the court to erase his conviction on the grounds that the pardon meant he didn’t do anything wrong. After all, the President of the United States said so. (Of course, the court didn’t buy that.) I’m pretty sure that D’Souza is thinking, at least to himself, along similar lines.

  209. 209
    Spanky says:

    @OzarkHillbilly: Being on my feet most of yesterday is what really aggravated it, I think. I really should have brought a heating pad in to the office today. I’ll keep a pad on it tonight and bring one in tomorrow. I’m already seeing a doc Wednesday for something else, so I’ll talk to him about the back.

  210. 210
    Hitlesswonder says:

    @janesays: I think this doesn’t help Warren at all….from the Verge:

    More importantly: who cares? Warren should never have made this claim to begin with. It doesn’t mean anything to possibly have 1/1024 Native American ancestry…

    The narrative that being 1/1024 Native American means you’re not and saying you are means you lied is the one that will resonate with the people Warren was trying to reach.

    And this is a particularly bad miscalculation because White Grievance is (ridiculously) the number one political issue in this country.

  211. 211
    Tokyokie says:

    @KSinMA: Climbing the family back to the early 17th century, one finds lots and lots of branches.

  212. 212
    Heidi Mom says:

    @FlipYrWhig: This is my understanding as well. Sherman Alexie says (IIRC), “They gave us the name Indian and now they want to take it away. Well, we won’t let them!” And when a white American referred to Russell Means as a Native American, he would respond “And where were YOU born?”

  213. 213
    Enhanced Voting Techniques says:

    @Hitlesswonder: Rub it in that to these a-holes their precious exceptialism is based on theft. They reason they scream about it is does hurt them.

  214. 214

    @Spanky: I had something sort of similar happen to me in college except it was one of the rib muscles that ran perpendicular to the spine. I had a cold too so every cough, sneeze ended with me crying and in agony. And every breath was painful. Not a darn thing doctors could do about it. I made do with over the counter anti-inflammatories. Also, my ex tore his bicep muscle completely off couple of years ago and had to have surgery to reattach it. After the reattachment he took lots of pain meds, did the alternating heat/cold therapy, and received lots of massages (painful massages) and lots of physical therapy. Of course, he had to have a working arm for his job as a firefighter.

    So if it’s just a strain, rest it as much as possible, take anti-inflammatories (if your liver and kidneys can handle it) and alternate cold/heat on it. If it’s completely torn, the tendon/muscle will curl up, the pain would be really intense and it should be obvious. If it’s partially torn, it hurts but you won’t have the same amount of muscle bunching. There would be swelling and stiffness as well. Hard to determine between partial tear and sprain sometimes but the fact that you are still in as much pain on day 9 as day 1 tells me you have a tear that’s not healing.

    Strongly advise you to see a doctor, specifically an orthopedic specialist to determine if it’s torn (and to what degree) or just strained (which I doubt considering your ongoing pain) and then you can decide what to do about it from there.

    That’s my 2 cents….

  215. 215
    OzarkHillbilly says:

    @Spanky: For some folks alternating ice and heat works but I’ve never tried it. I always use ice for the first 24-48 hrs then heat. Until I inevitably over do it, then I’ll use ice again for 24 hrs.

  216. 216
    trollhattan says:

    @OzarkHillbilly:
    What I’ve heard is tribal groups in CONUS and Alaska tend to prefer American Indian to native American, to distinguish them from Pacific Islanders such as native Hawaiians, Polynesians, American Samoans and such. Take that with a big ol’ salt grain of course.

  217. 217

    @Gravenstone: Please don’t use Indian Giver….Every Native American I’ve ever known find that term extremely offensive.

  218. 218
    catclub says:

    @Jim, Foolish Literalist:

    but we can have some fun pestering trump to cough up the million he promised an doesn’t have

    Better: “I guess you would pay it if you had that much money”

  219. 219
    Ruckus says:

    @Spanky:
    I’ve pulled both of the major back muscles at the same time at work. Which is what it sounds like you pulled. I was immobilized for over 2 weeks and took over 2 months to be back to anything like normal.
    These are big muscles and they do a lot of work.
    It takes time. See a doc. You never know what else you might have done. If anything. See a doc.

  220. 220
    Mnemosyne says:

    @Spanky:

    That’s not the kind of photo essay you usually get in a family newspaper … 🤔

  221. 221
    trollhattan says:

    @JaneE:
    MIL was a California Okie and later in life toyed with being “part Indian” on account of her first name (supposedly bestowed on her by the doctor who delivered her back in Oklahoma). We’ll never know, but it provided myriad amusing family discussions.

  222. 222
    Kelly says:

    @Mrs. D. Ranged in AZ: Funny thing is white folks keep taking things we’ve given Indians title to…

  223. 223
    Ruckus says:

    @MisterForkbeard:
    This. A thousand times.
    It’s a political party, not a kegger.

  224. 224
    OzarkHillbilly says:

    @Amir Khalid:

    Joe Arpaio accepted a Presidential pardon, and then petitioned the court to erase his conviction on the grounds that the pardon meant he didn’t do anything wrong.

    It’s kind of hard to convince a judge that one is actually innocent right after one has admitted actual guilt, especially with a complete lack of evidence for torture or other forms of coercion.

  225. 225
    catclub says:

    @Mrs. D. Ranged in AZ:

    Please don’t use Indian Giver

    yet another case of ‘everything is projection’. The whites were breaking every treaty as fast as they could.

  226. 226
    gwangung says:

    @Kraux Pas:

    But for the other part, what’s in a registration?

    If we’re talking about how an organization is structured and how it operates, it matters a hell of a lot.

    Want to change the direction of a group? Be an official part of it.

  227. 227
    WaterGirl says:

    BooMan has come out with a new post about the Dems having peaked too early and says 538 says we have only a 1 in 5 chance of winning the senate. His title “Perhaps the Dem’s Wave Crested Too Early” is no different than “Has the Dem’s Wave Crested Too Early?” (not linking because I am not encouraging anyone to read the post)

    How I long for the days when I didn’t feel like BooMan’s role was to provide discouragement.

    I think it’s the spin on the facts that bothers me the most. Not: hey, we are down to a 1 in 5 chance… we need to work our butts off to make this happen. Instead it’s: not looking good. Not helpful.

  228. 228
    catclub says:

    @JaneE:

    My documentation says 1/1024.

    Ten generations back, and only one direct relative? 1 parent = 50% = 1/2, 1 grandparent = 1/4 , 1 great-grandparent= 1/8= 1/2^3
    1024 = 2^10

  229. 229
    OzarkHillbilly says:

    @trollhattan: Shrug. They’ll let me know and until them I will beg forgiveness.

  230. 230

    @WaterGirl: That seem to be the self assigned job of many who call themselves liberals. To spread doom and gloom, so that D’s lose motivation.

  231. 231
    geg6 says:

    @Kraux Pas:

    But for the other part, what’s in a registration?

    Well, in my book, it means you can compete in races such as primaries against others with the same party designation. It means you get some say so, if you choose to be an active party member, in who and what the party supports or opposes.

    It means I have no use for anyone who isn’t a member of the party to stick their noses into what isn’t any of their business. That includes that fucking disgusting jackass, Wilmer, and you, if you aren’t a registered Democrat. I don’t give a flying fuck what non-Dems have to say about our party business and I will fight to the death anyone who isn’t a Dem voting in a Dem primary or suggesting that they should. Fuck that shit.

  232. 232
    catclub says:

    @Kraux Pas: I always liked the ‘Very Sorry Song’ from Calvin and Hobbes.

  233. 233
    OzarkHillbilly says:

    @WaterGirl:

    says 538 says we have only a 1 in 5 chance of winning the senate.

    So going from having NO chance of winning the senate to a 1 in 5 chance is a sign of cresting too soon? Maybe it’s just a sign of reality setting in.

  234. 234
    Gravenstone says:

    @Mrs. D. Ranged in AZ: Please note the immediate disclaimer following the suggestion. It’s in intentional poor taste, and I won’t repeat it, but it would basically be throwing Trump’s racist bullshit right back in his face in language his thumb sucking followers would understand.

  235. 235
    geg6 says:

    @NotMax:

    Well, you can’t go for it if you have no idea what that means. Which is pretty much where I stand.

  236. 236
    Ruckus says:

    @Mrs. D. Ranged in AZ:
    Industrial accident and cut a thumb tendon. Doc said as he was sewing me up, “Be very glad you only cut through 80% of the tendon because otherwise we’d be cutting your arm up to the elbow to find the tendon and reattach it.” Wore a very funny looking cast for 6 weeks and it took another 6 weeks of, as you said, painful therapy to get back to almost normal. This was 30 yrs ago and I still remember every detail. Your ex tearing it, that must have been painful in the tearing, as well as the therapy.

  237. 237
    Gravenstone says:

    @Kelly: Only those things we later decided we could make a buck off of.

  238. 238
    Gex says:

    @Mrs. D. Ranged in AZ: For some reason, there’s a certain subset of allies who think marginalized folks shouldn’t mind hearing offensive slurs that are used to oppress, marginalize, and harm them if only it is meant in jest by someone who “doesn’t mean it.” Or at least that they should be allowed to use those slurs for fun. The joy of wordplay is more valuable than not inflicting the phrase on Native readers.

    ETA: I noticed someone used “Welch” in a similar fashion upthread. The English language has all manner of terms with this similar meaning that are just slurs for other groups.

  239. 239
    Kelly says:

    I think every Democratic politician should start with “Trump has told x lies” when any of these bullshit Republican attacks comes up, where x = Daniel Dale’s lie count. Everybody, over and over “Trump has told x lies”. Power of repetition. Hell every Democrat in every interview and speech should shoehorn it in regardless of questions asked.

  240. 240
    Ken Shabby says:

    @Butter Emails!!!:

    Thought of that but, country outweighs state? I get that senate is also strategic but, have this dim hope she can lead. But, a lot depends on Legislature and who needs tack where.
    In that way, ‘18 is more important than ‘20 and first order business, in event.

  241. 241
  242. 242
    WaterGirl says:

    @schrodingers_cat: I don’t think BooMan sets out with that intent, but that sure is the end result for me when I read a lot of his stuff. sigh.

  243. 243
    ruemara says:

    @Kraux Pas: Mr. “I’m Not A Dem, but I will take their money & infrastructure” spends most of his time on air and critical of Dems. Hard pass on his friendship.

    @Gravenstone: hmm. Erm, I think it’s best if we follow the communities affected by the slur. It’s going to do anything but make it seem as if the term is acceptable, not shame those who’d use the term “Fauxcahontas”.

    @WaterGirl: A lot of people forget this but while the right gins up rage & fear for profit and to motivate their base; our side gins up fear and blame for a profit and to demotivate the base. It’s far more profitable for Dems to lose because the idea of rebellion for a righteous cause is a big seller.

    Also, if you don’t like what I just said, I SAID WHAT I SAID. I’m not gonna fight your feelings, but I stand by what I’ve observed. I will take my 1 in 5, because no one even thought Trump had a shot when he entered the presidential race. Guess what? Long shots sometimes work.

  244. 244
    trollhattan says:

    @OzarkHillbilly:
    This sort of thing is perpetually in motion regardless. What applies today won’t in five years.

  245. 245
    Enhanced Voting Techniques says:

    I think correct reply from Warren is “So he pay up on his own bet when he lost. Well that’s true to form for Trump”

  246. 246
    WaterGirl says:

    @OzarkHillbilly: That’s what I thought! 1 in 5 is a lot better than it seemed for awhile.

    As for polling – I just don’t seen how ANYONE can predict ANYTHING this year. None of the normal rules apply.

    I saw a clip from Beto yesterday saying that people are going to be surprised at the outcome (of his election) because a lot of people who will be voting are not being counted in the polls.

  247. 247
    Ken Shabby says:

    @MisterForkbeard:

    Understood. Here it is, in brief. Obama had the same vague negatives until everybody started paying attention and, by then, he’d gathered one hell of a momentum. The media had to finally shut up about it and cop self evidence. I wonder if Warren is similar.

    Or. Whomever gets her is going to have one powerful campaigner. She’d also be perfect VP but, I’d rather see her every GD day as chief executive.

    wait…that didn’t come out right….

    Prezzy Dent of All The Grown Ups. Fixed it.

  248. 248
    Gravenstone says:

    @Kelly: The problem there being that X has an ever increasing value > 0.

  249. 249
    Mnemosyne says:

    @Martin:

    She’s going to be attacked from all sides for reasons other than her age and gender.

    Yes, but BECAUSE she’s that kind of existential threat, they’re going to attack her on her age and gender to try and discredit her. They’re not going to engage with her ideas at all. They’re just going to say, What does an old white centrist woman who lied about her ethnicity know about anything?

  250. 250
    WaterGirl says:

    @ruemara: It’s like the old motto for the lottery. You can’t win if you don’t play.

    See prophecies, self-fulfilling.

    Everyone thought I was crazy for supporting Barack Obama in 2007, until they thought I wasn’t.

  251. 251
    Enhanced Voting Techniques says:

    I think I said it before that Warren got me to stop and listen to her on her you tube advert were my instinct was to just click passed it and I had no idea what Warren looked like. While her age is a concern because of this stupid Baby Boomer drama going, that’s basically Obama level charisma.

    Also Warren’s message is about the future, in contrasts to Trump which is basically go back to the 50s and despair, so that could get Warren passed the “oh this is the SOS with the Boombers” that turns off the younger voters.

  252. 252
    Jim, Foolish Literalist says:

    @MisterForkbeard: and after 2016, he spent much of 2017, while trump was solidifying the R base and Congress and cutting taxes for the rich and gutting health care, telling his cult-y followers that the Democratic Pahwty was a fayl-yuh. He’s a tumor.

    For the record, as a registered Democrat I voted mostly for Republicans and Greens.

    Good lord. Bleaty is even dumber than I thought.

  253. 253
    Ken Shabby says:

    @trollhattan:

    Or, if you get it correct, their tribal name in their language.
    Google will often take you right to it.

  254. 254
    FelonyGovt says:

    @OzarkHillbilly: The Speaker of the California Assembly spoke at the fundraiser I attended yesterday and he pointed out that Republicans always come home- they may say they prefer a generic Democratic candidate to a generic Republican one, but once there are actual people running, they’ll vote for the Republican. He thinks that goes a long way to explain the races “tightening”.

  255. 255
    Kraux Pas says:

    @geg6:

    It means I have no use for anyone who isn’t a member of the party to stick their noses into what isn’t any of their business. That includes that fucking disgusting jackass, Wilmer, and you, if you aren’t a registered Democrat.

    Well, a preponderance of the state parties disagree including in MA where I’m allowed to vote in the primary. Bernie was allowed to run. They let people in because we need numbers. Get on board with the party, maaaaaaaan.

  256. 256
    Ken Shabby says:

    @Mnemosyne:

    If (besides flying frogs and pigs) many fence sitters, independents and occasional tuned out/frustrated hear her lucidity above the slop, they may just begin to count…enough.
    If they go where the wind blows, she has the judo to take them there.

    She’s a goddamn grown up. It’s time the country started seeing one again.
    Orange Shitpile is raving inauthentic.
    Madam Professor hasn’t lost a student or uttered a false word yet.
    Authenticity for Daze.

  257. 257
    MisterForkbeard says:

    @Ken Shabby: I do think Warren makes a pretty fantastic VP, though as noted by a few others her Senate seat is not necessarily safe and the Republican governor would probably put in a Republican or a DINO.

    @Jim, Foolish Literalist: Yeah. He absolutely did a lot of negative things – he’s done a fair bit of campaigning for pet politicians while completely ignoring some of the races that were really important to the Party as a whole. I remember during the CA primaries, he dropped in to run a rally about a single candidate (long-shot berniecrat, though not a terrible candidate) and completely didn’t mention voting for Senate/Governor or other races where we had a potential to shut out Republicans completely. Instead he talked about this one candidate and then pushed on his message of overall corruption and malfeasance. He didn’t dump on the party directly, but he didn’t help at all.

  258. 258
  259. 259
    🇺🇸🌎 Goku (aka Amerikan Baka)  🗳🌷 says:

    @Kraux Pas:
    Don’t start that shit. Wilmer is a sanctimonious loser who only registered as Dem because that was the only way he was going to have a shot at being elected president.

    He’s only ever campaigned for his pet candidates as a commenter above points out. He’s not a team player and is largely out for his own self-aggrandizement

  260. 260
    dexwood says:

    @trollhattan:
    This old, white guy who grew up in Baltimore has been a member of a New Mexico Pueblo Indian family almost 45 years. Indian is the preferred word in the family and is still widely used throughout the state, We have Indian Country News, the Institute of American Indian Arts, the Indian Arts building and Indian village on the State Fair grounds, the Indian Pueblo Cultural Center, and other numerous examples. When not using the word Indian, my wife’s family, like others here, uses tribal affiliation when referring to Indian people. Oh, this Navajo guy or the woman from Zia. I think part of the confusion about what term to use is regional. I know Canadians who insist on First Americans and I know East and West coast whites who are always careful to use Native American or American Indian. We had visitors from Baltimore this summer who were surprised and shocked by how commonly used Indian is here in New Mexico among Indians, Anglos, and Hispanics. They thought Native American was the one true correct term.
    p.s. anglo is commonly used here to refer to white people. Just a quick comment before leaving the house for a few hours.

  261. 261
    Ken Shabby says:

    @WaterGirl:

    Precisely. Same, this address.

    “Yes, but he’s …black.”

    I know. Innit great?

    Lots of that and with Liberals in my age group. Only time I mentioned to Republicans was to upset them.

    “You’re just going to Love it”

    Good times.

  262. 262
    MisterForkbeard says:

    @Jim, Foolish Literalist:

    For the record, as a registered Democrat I voted mostly for Republicans and Greens.

    If that was in the last 30 years, there’s no excuse for this. Particularly if someone wants to lecture us on supporting Senator Sanders. If you couldn’t see how morally corrupt they were in the 90s,… though this does kind of fit my preconceptions about the stereotypical Bernie voter. Voting for greens or Republicans if you liked Bernie NEVER made sense – your goals were much better served with both the stated goals and actions of the Democrats. But good for him on voting Dem now – I hope he keeps it up and I welcome his participation. Likewise, there are some states where it makes sense to not be part of the Democratic Party for primary reasons, but I don’t think MA is one of them.

    But “participation” isn’t “lecturing”, and while I’m happy to have their help… they’re pissing inside the tent as well as out, and if they want to be welcome they need to keep that shit outside.

  263. 263
    Fleeting Expletive says:

    I grew up in Oklahoma and am Native American at about the same degree as Senator Warren. NBD for people who live there but are “undocumented” Indians, pretty much everybody. My ancestors apparently were in Arkansas or further east when the Dawes commission rolls closed and most likely, being stubborn survivors, wouldn’t have consented to sign anything the white government told them to sign. Besides old pictures the only evidence I’ve seen is an uncanny resemblance between some of my uncles and portraits of Mvskoke (aka Muskogee) Creek
    elders in the Creek Nation Tribal headquarters in Okmulgee.

    I don’t want to give the genealogy people my DNA, but in eastern Oklahoma the public library system has amazing genealogy resources for those who are trying to find Dawes ancestors if they have them.

  264. 264
    Immanentize says:

    I just got back from class — checked out the thread. It is pretty clear this is leaving a mark by the number of new nyms telling us this ain’t shit and that we should despair and throw in the towel.

    As for Warren running, I really don’t know if she will, but as one of her constituents, First, I hope she doesn’t and Second, I know that if she does she would — at a minimum — push the Overton window left. And she would not do it in a way that proved destructive to any eventual candidate (I’m looking at you, Bern). In fact, her getting in would eliminate the purpose of a second Bernie run.

  265. 265
    🇺🇸🌎 Goku (aka Amerikan Baka)  🗳🌷 says:

    @Immanentize:
    Some of them aren’t new and were more active regulars as of a few months to a year ago, tbf.

  266. 266
    Brent says:

    Ah yes. Two references to Trump as a “Welcher” and one as an “Indian giver”. I do sure love how we use terms for other groups of people as being synonymous with being untrustworthy as we criticize his racism.

  267. 267
  268. 268
    Immanentize says:

    New Beto commercial with our same diner friend. This time on the burger wars.

    C’mon, Teeeddd.

  269. 269
    🇺🇸🌎 Goku (aka Amerikan Baka)  🗳🌷 says:

    @Immanentize:
    I specifically remember Kraux Pas from the 2016 primaries. Bobby Johnson comments here infrequently but was much more of a regular earlier this year and last, IIRC.

    Whenever I go on LGM, I recognize plenty of nyms that were regular commenters on BJ once upon a time. I wonder why that is?

  270. 270
    Ken Shabby says:

    @trollhattan:

    Sure but, am hazarding guess it won’t stick except for a core group of Neanderthals and their abused wives. With apology to Neanderthals.

    If style matters, and here it does, she’s almost immediately not like Clinton. This is not to shade her in any way. Again, she won by 3 million votes. Am wondering if Warren can do even better. Only similarities are ‘senate’, ‘gender’ and ‘demonrat’. Also throw in ‘librul’ and ‘godless taxes librul soft on Your Preferred Fear Rage Goes Here librul’. Also, too ‘LIBRUL’.

    Fck those people.

    I don’t know how anyone can’t point at Warren, other than a flaming, hateful lunatic, and say “I don’t like her”.

    I hope those homes have the little woman saying, get your own supper, bitch.

  271. 271
    Immanentize says:

    @🇺🇸🌎 Goku (aka Amerikan Baka)  🗳🌷: Oh, I remember those two — I was talking about someone in the former thread with just initials and Witless here.

  272. 272
    MisterForkbeard says:

    @🇺🇸🌎 Goku (aka Amerikan Baka)  🗳🌷:

    Whenever I go on LGM, I recognize plenty of nyms that were regular commenters on BJ once upon a time. I wonder why that is?

    To be fair, we’re often assholes and a few of them left for that reason. They’re also a bit more Bernie friendly over there. :)

  273. 273
    Immanentize says:

    @Ken Shabby: Her contacts are national too — Oklahoma, Texas, Massachusetts. She really connects with people and she raises money like a Boss. And, she is smart. Very smart. Which is probably her biggest liability these days.

    Shit, if she gets elected, I might even go work in her admin.

  274. 274
    Immanentize says:

    @🇺🇸🌎 Goku (aka Amerikan Baka)  🗳🌷: Odd to say, but LGM has a much more argumentative comments section. Pretty mean at times.

  275. 275
    polyorchnid octopunch says:

    @dexwood: In Canada, it’s First Nations, not First Americans, and it’s what one uses when one doesn’t know the specific nation a given individual is a member of. So, my friend Pete is a Tyendinaga mohawk, his buddy visiting him from up around the Hudson’s Bay area is First Nations until I find out if he’s Cree or Innu.

  276. 276
    dexwood says:

    @polyorchnid octopunch
    Oops, sorry, that’s what I meant, had intended to write.
    From my phone and on the run…

  277. 277
    KSinMA says:

    @Tokyokie: Yep. Quite a prolific bunch, they were. That was true right down to my grandmother’s generation in my little branch.

  278. 278

    @Kelly: @catclub: And that is exactly what my Native American friends (and ex husband) used to say. That the irony was that it was the whites that actually took things back and never kept their word. It’s what makes the insult so infuriating.

  279. 279

    @Gravenstone: I did note the disclaimer but I just felt the use of it was far too inflammatory and the “joy of wordplay” (as Gex put it) wasn’t worth it. I know it’s tempting to shove stuff back in Trumpov’s supporters’ faces but we can insult them plenty without stooping to their level. After all, they are a bunch of easily provoked ‘morans’.

    @Gex:I honestly didn’t know “welcher” was a ethnic slur! Thank you for letting me know (being sincere here).

  280. 280
    janesays says:

    @Hitlesswonder: Right, I think the 1/1024th figure is the one that a lot of people are going to be hearing the most, and if she is in fact 99.9% non-Native American, it seems a bit disingenuous to claim NA ancestry.

    There’s a very strong likelihood that I’m 1/512th sub-Saharan African (great-great-great-great-great-great-great-grandmother on my mother’s side), but I’m as European white looking as any other white person, and I believe most people would be (justifiably) offended if I started to characterize myself as having African-American ancestry.

  281. 281
    debbie says:

    Someone on NPR pointed out that the Trumps presented themselves as Swedes in order to attract Jewish buyers. I don’t see it mentioned here, so I guess it must be bogus. Pity.

  282. 282
    janesays says:

    @WaterGirl: The reality is that the Senate has always been a tremendous longshot, given the map we have to work with. If we don’t win the majority, that alone wouldn’t automatically mean we had a bad election cycle. Because the odds of pulling that off were never that great to begin with. A year ago, almost nobody was talking about the Democrats having any hope of winning a Senate majority. About six months ago, the odds of it happening started to steadily climb, and people started to say it’s actually possible. But even when we were feeling the most optimistic about it, it still wasn’t a probable outcome. Things have cooled off a little bit, a number of polls have shifted the wrong way, and people are starting to come to grips with the likelihood that the Democrats won’t take over the Senate.

    That doesn’t mean we should give up all hope or stop fighting like hell to pull off the improbable, just temper your expectations so you don’t find yourself buying into narratives that the Democrats blew it if they pick up 35-40 House seats but have a net loss of one seat in the Senate. Odds are the Senate is going to be somewhere between 53-47 Republican majority and 51-49 Democratic majority at the end of the night on November 6th. Four of those five possible outcomes (53-47 R, 52-48 R, 51-49 R, 50-50, 50-49 D) leave the Republicans in majority control (Pence being the tiebreaker if it ends up 50-50).

  283. 283
    Matt McIrvin says:

    @janesays: She’s not so much trying to claim Native American identity as trying to counter a narrative that she’s an affirmative-action faker. It’s got her in a tough spot where basically any possible action she takes is problematic in some way.

    I agree that she shouldn’t have made the claim in the first place, but it started back in the ’90s when a lot of white people were pretty clueless about this sort of thing, she never actually got anything out of it, and she didn’t make a big deal out of it during her political career until her opposition dredged it up as a smear, to exploit white right-wing fears of affirmative action and give people an excuse to throw around slurs about Indians. And now there’s some evidence that it wasn’t even made up out of whole cloth (a lot of families’ stories of this type are).

  284. 284
    Matt McIrvin says:

    @WaterGirl: That article is weird–he’s acting as if Republicans being favored to keep the Senate is some kind of new development, rather than having been the case for the entire campaign because of a difficult map. He’s mistaking a constant state for a trend. The Democrats’ position according to 538 got worse in early October, but that seems to have to do with individual races like Heitkamp’s more than some sort of national phenomenon–the Senate is such that control rests on small-number phenomena.

    I thought he’d seen some kind of dramatic new indication that the Dems were set to lose the House, but as far as I can tell there is no such thing.

Comments are closed.